Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 91069275 91082044 enh64811

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 91080633 rs537685224 GAATGAGGACATGCTTTATAAAAAGAA G 3725352

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results