EnhancerDB
  1. Home
  2. TFBS
  3. GLIS1[chr14:94426303-94426319]
Chromosome characteristics of GLIS1[chr14:94426303-94426319]
Back to top
Enhancers possibly regulated by GLIS1[chr14:94426303-94426319]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 94421285 94433995 enh15895
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Large Intestine Esophagus Astrocyte Blood (OCI-LY7) Stomach Placenta Peripheral Blood (MM.1S) Lung (PC-9) Blood (T-cell) Heart
SNP sites on GLIS1[chr14:94426303-94426319]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 94426316 rs6145448 GTGCCATGAGTCTACCCCACGCCCACCCCA G 3745685
chr14 94426316 rs71129666 GTGCCATGAGTCTACCCCACGCCCACCCCA G 3745686
Genes possibly regulated by GLIS1[chr14:94426303-94426319]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GLIS1[chr14:94426303-94426319]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results