| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 94622685 | 94633435 | enh104041 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 94624167 | rs140324049 | TCCAAGGTCACATAGCTAGTGAGGGGCAGGA | T | 3747073 | |
| chr14 | 94624167 | rs368799581 | TCCAAGGTCACATAGCTAGTGAGGGGCAGGA | T | 3747074 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|