Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 94622685 94633435 enh104041

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 94624167 rs140324049 TCCAAGGTCACATAGCTAGTGAGGGGCAGGA T 3747073
chr14 94624167 rs368799581 TCCAAGGTCACATAGCTAGTGAGGGGCAGGA T 3747074
chr14 94624169 rs558159580 C T 3747075

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results