Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 96678413 96686110 enh58612

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 96683991 rs576127006 GGGGGGCTGGGGGTCTATCCC G 3762911

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results