EnhancerDB
  1. Home
  2. TFBS
  3. TBX19[chr14:100130819-100130839]
Chromosome characteristics of TBX19[chr14:100130819-100130839]
Back to top
Enhancers possibly regulated by TBX19[chr14:100130819-100130839]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100129248 100137525 enh60521
Neural Stem Cells (H9) Blood (OCI-LY7)
SNP sites on TBX19[chr14:100130819-100130839]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100130819 rs369283638 GAGTGACACCCGAGTGTGGAAAACC G 3784271
chr14 100130819 rs566034084 GAGTGACACCCGAGTGTGGAAAACC G 3784272
chr14 100130828 rs59885041 CCG C 3784273
Genes possibly regulated by TBX19[chr14:100130819-100130839]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TBX19[chr14:100130819-100130839]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results