Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100602865 100609830 enh109661

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100608581 rs543161711 AAGGTCTACAGAAGCACCTTCCAGGCTTG A 3787886

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results