Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 101961825 101966235 enh99198

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101966211 rs147894535 TTTGCTCTGCAGCCAAGCGCC T 3798625
chr14 101966211 rs149680990 TTTGCTCTGCAGCCAAGCGCC T 3798626

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results