Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 102527288 102532575 enh15960

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 102528678 rs367760490 CTGTAGCCCAGGCTGGAGTCACGCTG C 3801836
chr14 102528678 rs537470207 CTGTAGCCCAGGCTGGAGTCACGCTG C 3801837
chr14 102528679 rs553969529 T C 3801838

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results