| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 103587345 | 103595599 | enh15972 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 103594018 | rs112383314 | G | GGAGGGGTGTC,GGAGGGGTGTCGAGGGGTGTCGAGGGGTGTC,GGAGGGGTGTT | 3810874 | |
| chr14 | 103594018 | rs373707087 | G | GGAGGGGTGTT | 3810875 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|