| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 103757109 | 103765555 | enh80934 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 103758906 | rs371253713 | G | GACTTTCAATCGACAGGGGCTGCATCTGAA | 3812843 | |
| chr14 | 103758906 | rs562117074 | G | GACTTTCAATCGACAGGGGCTGCATCTGAA | 3812844 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|