Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103757109 103765555 enh80934

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103758906 rs371253713 G GACTTTCAATCGACAGGGGCTGCATCTGAA 3812843
chr14 103758906 rs562117074 G GACTTTCAATCGACAGGGGCTGCATCTGAA 3812844

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results