Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104041045 104045255 enh31180

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104041100 rs575625397 GCTGGAGAGGTGGGGTCTTGCGGGCC G 3815494

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results