Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104749554 104768875 enh68851

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104749971 rs561876543 ACTGTGCCTTCTGGGAAGGCTG A 3820798

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results