EnhancerDB
  1. Home
  2. TFBS
  3. H4TF2[chr14:105126697-105126701]
Chromosome characteristics of H4TF2[chr14:105126697-105126701]
Back to top
Enhancers possibly regulated by H4TF2[chr14:105126697-105126701]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105120721 105134695 enh3485
Cervix (HeLa-S3) Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Blood (Karpas-422) Pancreas Thymus Epithelial (MCF-7)
SNP sites on H4TF2[chr14:105126697-105126701]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105126701 rs140669483 CCTCCGTCTGGAGCCCCTCCCGATGGCCGTCG C 3824244
chr14 105126701 rs58384467 CCTCCGTCTGGAGCCCCTCCCGATGGCCGTCG C 3824245
Genes possibly regulated by H4TF2[chr14:105126697-105126701]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by H4TF2[chr14:105126697-105126701]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results