Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105236365 105240515 enh109664

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105240503 rs200775205 CACACCCCATCACACTGCCCCACACCAT C 3825553

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results