Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 27154983 27155478 vista886

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 27155243 rs531388541 AAGCTCTGGGGGGCCCAGAGCTC A 182420

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results