EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB7A[chr16:81470869-81470881]
Chromosome characteristics of ZBTB7A[chr16:81470869-81470881]
Back to top
Enhancers possibly regulated by ZBTB7A[chr16:81470869-81470881]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 81453285 81472414 enh31955
Prostate (PC-3) Lung (PC-9) Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Colon (HCT116) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Thymus Stomach
SNP sites on ZBTB7A[chr16:81470869-81470881]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 81470869 rs548561246 C G,T 4582529
chr16 81470870 rs541050367 CCTGTGGTCCCAGCTACTTGGGAGG C 4582530
Genes possibly regulated by ZBTB7A[chr16:81470869-81470881]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB7A[chr16:81470869-81470881]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 81644992 81645011 + hsa-miR-6504-3p MIMAT0025465 81478590 0.916667 0.0 7709 630
Expression level of miRNAs
Back to top