Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84206965 84211115 enh99362

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84210095 rs548540321 TAGCCAGCCTGGGCCAGGAAGCCACCG T 4605169
chr16 84210095 rs66573559 TAGCCAGCCTGGGCCAGGAAGCCACCG T 4605170

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results