Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85665148 85681115 enh16875

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85670509 rs572813710 ACCCCCCAGCTCCCCTGTGCTAC A 4626789

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results