EnhancerDB
  1. Home
  2. TFBS
  3. ONECUT3[chr12:52070828-52070842]
Chromosome characteristics of ONECUT3[chr12:52070828-52070842]
Back to top
Enhancers possibly regulated by ONECUT3[chr12:52070828-52070842]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52066965 52074176 enh47580
Brain (SK-N-SH) Muscle (A673) Peripheral Blood (MM.1S) Thymus Stomach
SNP sites on ONECUT3[chr12:52070828-52070842]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52070840 rs200811022 GTTTTATTTTA G 2631985
chr12 52070840 rs370865556 GTTTTA G 2631986
chr12 52070840 rs540385035 GTTTTATTTTATTTTATTTTA G 2631987
chr12 52070840 rs58540656 GTTTTATTTTATTTTATTTTA G 2631988
chr12 52070840 rs75207917 GTTTTA G 2631989
Genes possibly regulated by ONECUT3[chr12:52070828-52070842]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ONECUT3[chr12:52070828-52070842]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results