Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 86615965 86626395 enh31991

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 86622822 rs563502138 GAGCAGCTTTAAAGGTGCTGGC G 4639038

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results