Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 67045454 67050471 enh68166

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 67050147 rs554041256 GGCTTTATTGCAAAATCTAAATATCT G 2699834

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results