Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 67431505 67458235 enh14797

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 67454342 rs371273132 TGTAATCCCAGCACTTTGGGAA T 2702350
chr12 67454342 rs554884098 TGTAATCCCAGCACTTTGGGAA T 2702351
chr12 67454347 rs139644286 T C 2702352

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results