Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 68770745 68777495 enh80241

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 68771025 rs371063891 CCCGGGCCCCCACTCCGTTTCTGTATTGCCCT C 2710550

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results