Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 69000485 69015035 enh2424

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 69011527 rs564861621 AACCATAAAATAATACAGTAAT A 2712746

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results