Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 72238225 72248315 enh2452

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 72245571 rs144175022 GCCCTGTGGCGTTGCAGGGCTCAGC G 2727838
chr12 72245571 rs377422523 GCCCTGTGGCGTTGCAGGGCTCAGC G 2727839

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results