Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 72499514 72504915 enh68175

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 72501589 rs549308479 GTTTAGACATTTTTTGAAATCTAA G 2728802

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results