Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 87415345 87424531 enh4178

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 87418501 rs542654907 CTGGGCGCGGTGGCTCACGT C 4649673

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 87417601 87438385 + MAP1LC3B ENSG00000140941.8 87417601 0.61 1.0 900 15144


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results