| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 88040585 | 88061035 | enh4183 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 88044520 | rs11271660 | G | GCATTTAGCTACAAACATGCCTCGAA | 4657455 | |
| chr16 | 88044520 | rs138959850 | G | GCATTTAGCTACA,GCATTTAGCTACAAACATGCCTCGAA | 4657456 | |
| chr16 | 88044535 | rs141271224 | A | G | 4657457 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|