EnhancerDB
  1. Home
  2. TFBS
  3. SMAD2[chr16:88048687-88048700]
Chromosome characteristics of SMAD2[chr16:88048687-88048700]
Back to top
Enhancers possibly regulated by SMAD2[chr16:88048687-88048700]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88040585 88061035 enh4183
Prostate (PC-3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung (A549) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Muscle (Myoblast) Stomach
SNP sites on SMAD2[chr16:88048687-88048700]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88048691 rs537844297 CCTGTCCCCTCTGCCCGTCCCTCTG C 4657534
chr16 88048693 rs116374721 T C 4657535
chr16 88048697 rs62049279 C A,T 4657536
Genes possibly regulated by SMAD2[chr16:88048687-88048700]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SMAD2[chr16:88048687-88048700]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results