Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88048691 rs537844297 CCTGTCCCCTCTGCCCGTCCCTCTG C 4657534
chr16 88048693 rs116374721 T C 4657535

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results