Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 92485345 92494995 enh29860

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 92487968 rs368295333 TCAGCCTCCCAAAATGGTGGGATTA T 2801251
chr12 92487968 rs376648667 TCAGCCTCCCAAAATGGTGGGATTA T 2801252

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results