Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 93768965 93774615 enh99007

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 93772200 rs543720617 AGGGCGCCCGGCGCCGCACGCTGCCCTCCG A 2811638

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 93771659 93797024 + NUDT4 ENSG00000173598.9 93771659 0.77 0.95 522 12403


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results