Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88556185 88579980 enh52393

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88565781 rs376685020 CAGAGCAGCCGCGGAGGAGAAG C 4664430
chr16 88565781 rs71391389 CAGAGCAGCCGCGGAGGAGAAG C 4664431

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results