EnhancerDB
  1. Home
  2. TFBS
  3. RFX5[chr12:95493646-95493661]
Chromosome characteristics of RFX5[chr12:95493646-95493661]
Back to top
Enhancers possibly regulated by RFX5[chr12:95493646-95493661]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 95488285 95497975 enh14915
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Lung (PC-9) Liver Placenta Colon (HCT116) Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Heart
SNP sites on RFX5[chr12:95493646-95493661]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 95493658 rs375085922 GGGAGTACTAGGCTCTCCCC G 2824085
chr12 95493658 rs544419802 GGGAGTACTAGGCTCTCCCC G 2824086
Genes possibly regulated by RFX5[chr12:95493646-95493661]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX5[chr12:95493646-95493661]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results