Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88946220 88957735 enh44357

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88948971 rs375858248 GGCATGGCTGTGGGCGTGGCTGTGTGT G 4669231
chr16 88948971 rs528483359 GGCATGGCTGTGGGCGTGGCTGTGTGT G 4669232
chr16 88948971 rs77571900 GGCATGGCTGTGGGCGTGGCTGTGTGT G 4669233

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results