Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89029754 89041849 enh47986

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89032863 rs149642843 GCCACACCCTCATCCCACCTGGGGTGACCA G 4670541
chr16 89032863 rs377704397 GCCACACCCTCATCCCACCTGGGGTGACCA G 4670542

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results