Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89169305 89177115 enh96724

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89172213 rs572831019 TGAGGGCAGGTTGGTTCCATCGTCCCG T 4672727

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results