Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 101621685 101631775 enh29928

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 101630836 rs144873186 GAGCCACTGTACCTGGTCAAA G 2851418
chr12 101630839 rs548495755 C A,G 2851419

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results