| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 107253805 | 107261664 | enh29965 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 107254740 | rs144411767 | GTAGGCAAACCAGAGACTCTGTGAAGTCTTC | G | 2879539 | |
| chr12 | 107254740 | rs376400801 | GTAGGCAAACCAGAGACTCTGTGAAGTCTTC | G | 2879540 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|