Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 107253805 107261664 enh29965

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 107254740 rs144411767 GTAGGCAAACCAGAGACTCTGTGAAGTCTTC G 2879539
chr12 107254740 rs376400801 GTAGGCAAACCAGAGACTCTGTGAAGTCTTC G 2879540

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results