Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 107760925 107781907 enh29971

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 107776493 rs143410474 CACATGGACACAGGGAGGGGAACATCACACACT C 2882339

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results