EnhancerDB
  1. Home
  2. TFBS
  3. PAX9[chr7:389574-389591]
Chromosome characteristics of PAX9[chr7:389574-389591]
Back to top
Enhancers possibly regulated by PAX9[chr7:389574-389591]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 387285 423895 enh23904
Liver (HepG2) Large Intestine Prostate (RWPE1) Esophagus Blood (T-cell) Stomach Muscle (A673) Placenta Breast Pancreas Thymus Epithelial (MCF-7)
SNP sites on PAX9[chr7:389574-389591]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 389576 rs373935783 GTCTCGCCTCAGTGCCAGCGGCAGACCC G 9560349
chr7 389576 rs550309547 GTCTCGCCTCAGTGCCAGCGGCAGACCC G 9560350
chr7 389581 rs527806922 G A 9560351
Genes possibly regulated by PAX9[chr7:389574-389591]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PAX9[chr7:389574-389591]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results