Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 387285 423895 enh23904

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 389576 rs373935783 GTCTCGCCTCAGTGCCAGCGGCAGACCC G 9560349
chr7 389576 rs550309547 GTCTCGCCTCAGTGCCAGCGGCAGACCC G 9560350
chr7 389581 rs527806922 G A 9560351

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results