Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 115071610 115079035 enh15006

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 115076583 rs574329749 T TCTCCTGACCTCGTGATCTGCC 2913991

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results