Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 118223485 118232595 enh68287

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 118229045 rs377162427 C CTTCAGGAGCTTGCTTCCTG 2935784
chr12 118229045 rs548556398 C CTTCAGGAGCTTGCTTCCTG 2935785

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results