Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 119620485 119630864 enh15039

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 119624499 rs56836137 TTGGAAGATTTGGTACAACACA T 2940600
chr12 119624499 rs866752976 TTGGAAGATTTGGTACAACACA T 2940601

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results