Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 123420205 123434235 enh15076

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 123432289 rs67354229 TGATGGCATCACAGCGGGCCCGC T 2961215

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results