Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 124623565 124628375 enh68306

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124628264 rs539129785 AAGTATTTCATCCATGCCTAATGG A 2965839

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results