Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 124706445 124727275 enh43847

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124712435 rs368150640 GGTGGGGACAAGGCTGAGTTGT G 2966518
chr12 124712435 rs545599323 GGTGGGGACAAGGCTGAGTTGT G 2966519

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results