Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1081405 1094799 enh23916
chr7 1092665 1092797 vista54768

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1092792 rs140990456 T TGGGCACAGAGGCAAGTGGG 9568992

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results