Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1130645 1146579 enh56136
chr7 1140726 1141099 vista54774

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1141004 rs547022410 G GCTGCTGGGAGTCCCCAGAGGGGCC 9569712
chr7 1141006 rs550267578 T C 9569713

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results